Chroococcus sp. CCY1214

Description

Description: Chroococcus is a single cell cyanobacteria. Chroococcus is usually found in colonies of 2, 4 or 8 cells.

Isolated from: Salinas in Olhao, Portugal.

Type of sample: sediment.

Incubation T°: 23°C.

Light cycle: 16 light/ 8 dark

Medium: 2xASN

Strain description
ssu rRNA sequence
atgccgcgctyactgactgactgatgactgactagcatcgatcgatcgactagctagcatcgatcgatgatgactagtagcatgacgatcgcgcgcgaatgagccgtacgacgatcgatgactagctagctcatgcatcgatcgatcgatcgacgcgcgcgctacgatcggcgcgatcgatcgcgccgcgcgccgataaatattataattgccgatctacgctagctgactattatctgatcgatcgatcgatatat
Literature

Go back